unix % water
Smith-Waterman local alignment.
Input sequence: tembl:xlrhodop
Second sequence: tembl:xl23808
Gap opening penalty [10.0]:
Gap extension penalty [0.5]:
Output file [xlrhodop.water]:
unix % more xlrhodop.water
Local: XLRHODOP vs XL23808 Score: 7448.00 XLRHODOP 2 gtagaacagcttcagttgggatcacaggcttctagggatcctttg 46 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1182 gtagaacagcttcagttgggatcacaggcttctagggatcctttg 1226 XLRHODOP 47 ggcaaaaaagaaacacagaaggcattctttctatacaagaaagga 91 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1227 ggcaaaaaagaaacacagaaggcattctttctatacaagaaagga 1271 XLRHODOP 92 ctttatagagctgctaccatgaacggaacagaaggtccaaatttt 136 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1272 ctttatagagctgctaccatgaacggaacagaaggtccaaatttt 1316 XLRHODOP 137 tatgtccccatgtccaacaaaactggggtggtacgaagcccattc 181 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1317 tatgtccccatgtccaacaaaactggggtggtacgaagcccattc 1361 XLRHODOP 182 gattaccctcagtattacttagcagagccatggcaatattcagca 226 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1362 gattaccctcagtattacttagcagagccatggcaatattcagca 1406 XLRHODOP 227 ctggctgcttacatgttcctgctcatcctgcttgggttaccaatc 271 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1407 ctggctgcttacatgttcctgctcatcctgcttgggttaccaatc 1451 XLRHODOP 272 aacttcatgaccttgtttgttaccatccagcacaagaaactcaga 316 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1452 aacttcatgaccttgtttgttaccatccagcacaagaaactcaga 1496 XLRHODOP 317 acacccctaaactacatcctgctgaacctggtatttgccaatcac 361 ||||||||||||||||||||||||||||||||||||||||||||| XL23808 1497 acacccctaaactacatcctgctgaacctggtatttgccaatcac 1541
In these cases we have not had to adjust the gap parameters from the defaults used in these programs. You should be aware that you may need to do so with your own sequences.
EMBOSS contains other pairwise alignment programs - stretcher
and matcher are global and local alignment programs respectively that are
less rigorous than needle and water and therefore run
more quickly; they may be useful for database
searching. supermatcher is designed for local alignments of
very large sequences and is even less rigorous in its
implementation. The documentation pages for all these programs can be
found at
http://www.uk.embnet.org/Software/EMBOSS/Apps/index.html