next up previous
Next: Protein analysis Up: Local alignment Previous: Local alignment

Exercise: water

unix % water
Smith-Waterman local alignment.
Input sequence: tembl:xlrhodop
Second sequence: tembl:xl23808
Gap opening penalty [10.0]:
Gap extension penalty [0.5]:
Output file [xlrhodop.water]:

unix % more xlrhodop.water

Local: XLRHODOP	vs XL23808
Score: 7448.00

XLRHODOP	2     gtagaacagcttcagttgggatcacaggcttctagggatcctttg 46
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1182  gtagaacagcttcagttgggatcacaggcttctagggatcctttg 1226

XLRHODOP	47    ggcaaaaaagaaacacagaaggcattctttctatacaagaaagga 91
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1227  ggcaaaaaagaaacacagaaggcattctttctatacaagaaagga 1271

XLRHODOP	92    ctttatagagctgctaccatgaacggaacagaaggtccaaatttt 136
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1272  ctttatagagctgctaccatgaacggaacagaaggtccaaatttt 1316

XLRHODOP	137   tatgtccccatgtccaacaaaactggggtggtacgaagcccattc 181
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1317  tatgtccccatgtccaacaaaactggggtggtacgaagcccattc 1361

XLRHODOP	182   gattaccctcagtattacttagcagagccatggcaatattcagca 226
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1362  gattaccctcagtattacttagcagagccatggcaatattcagca 1406

XLRHODOP	227   ctggctgcttacatgttcctgctcatcctgcttgggttaccaatc 271
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1407  ctggctgcttacatgttcctgctcatcctgcttgggttaccaatc 1451

XLRHODOP	272   aacttcatgaccttgtttgttaccatccagcacaagaaactcaga 316
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1452  aacttcatgaccttgtttgttaccatccagcacaagaaactcaga 1496

XLRHODOP	317   acacccctaaactacatcctgctgaacctggtatttgccaatcac 361
		      |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1497  acacccctaaactacatcctgctgaacctggtatttgccaatcac 1541
$\vdots$

Scroll down the entire output and again, note that five exons have been found.

In these cases we have not had to adjust the gap parameters from the defaults used in these programs. You should be aware that you may need to do so with your own sequences.

EMBOSS contains other pairwise alignment programs - stretcher and matcher are global and local alignment programs respectively that are less rigorous than needle and water and therefore run more quickly; they may be useful for database searching. supermatcher is designed for local alignments of very large sequences and is even less rigorous in its implementation. The documentation pages for all these programs can be found at
http://www.uk.embnet.org/Software/EMBOSS/Apps/index.html



EMBnet
2003-09-10