![]() |
prettyseq |
The translated nucleic acid region will be shown in lower-case letters while the rest of the input sequence will be left in the input case.
The base and residue numbers of the sequences are shown beside the sequences in the output.
Slightly unusually, this application uses the codon usage tables to translate the codons.
% prettyseq Output sequence with translated ranges Input sequence: tembl:paamir Range(s) to translate [1-2167]: 135-1292 Output file [paamir.prettyseq]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] sequence Sequence USA -range range Range(s) to translate [-outfile] outfile Output file name Additional (Optional) qualifiers: -[no]ruler boolean Add a ruler -[no]plabel boolean Number translations -[no]nlabel boolean Number DNA sequence Advanced (Unprompted) qualifiers: -cfile codon Codon usage table name -width integer Width of screen Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of the sequence to be used -send1 integer End of the sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report deaths |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence USA | Readable sequence | Required |
-range | Range(s) to translate | Sequence range | Whole sequence |
[-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.prettyseq |
Additional (Optional) qualifiers | Allowed values | Default | |
-[no]ruler | Add a ruler | Boolean value Yes/No | Yes |
-[no]plabel | Number translations | Boolean value Yes/No | Yes |
-[no]nlabel | Number DNA sequence | Boolean value Yes/No | Yes |
Advanced (Unprompted) qualifiers | Allowed values | Default | |
-cfile | Codon usage table name | Codon usage file in EMBOSS data path | Ehum.cut |
-width | Width of screen | Integer 10 or more | 60 |
ID PAAMIR standard; DNA; PRO; 2167 BP. XX AC X13776; M43175; XX SV X13776.1 XX DT 19-APR-1989 (Rel. 19, Created) DT 17-FEB-1997 (Rel. 50, Last updated, Version 22) XX DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation XX KW aliphatic amidase regulator; amiC gene; amiR gene. XX OS Pseudomonas aeruginosa OC Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas. XX RN [1] RP 1167-2167 RA Rice P.M.; RT ; RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases. RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG. XX RN [2] RP 1167-2167 RX MEDLINE; 89211409. RA Lowe N., Rice P.M., Drew R.E.; RT "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas RT aeruginosa"; RL FEBS Lett. 246:39-43(1989). XX RN [3] RP 1-1292 RX MEDLINE; 91317707. RA Wilson S., Drew R.; RT "Cloning and DNA seqence of amiC, a new gene regulating expression of the RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC RT product."; RL J. Bacteriol. 173:4914-4921(1991). XX RN [4] RP 1-2167 RA Rice P.M.; RT ; RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases. RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG. XX DR SWISS-PROT; P10932; AMIR_PSEAE. DR SWISS-PROT; P27017; AMIC_PSEAE. DR SWISS-PROT; Q51417; AMIS_PSEAE. [Part of this file has been deleted for brevity] FT phenotype" FT /replace="" FT /gene="amiC" FT misc_feature 1 FT /note="last base of an XhoI site" FT misc_feature 648..653 FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes FT constitutive expression of amiE" FT conflict 1281 FT /replace="g" FT /citation=[3] XX SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other; ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60 ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120 aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180 aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240 agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300 ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360 tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420 agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480 acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540 ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600 gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660 acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720 cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780 ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840 aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900 acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960 tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020 tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080 acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140 gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200 agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260 ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320 cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380 gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440 gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500 gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560 cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620 tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680 gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740 ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800 gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860 aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920 catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980 gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040 gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100 ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160 cctcgag 2167 // |
You can specifiy a file of ranges to extract by giving the '-range' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-range @myfile').
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
PRETTYSEQ of PAAMIR from 1 to 2167 ---------|---------|---------|---------|---------|---------| 1 GGTACCGCTGGCCGAGCATCTGCTCGATCACCACCAGCCGGGCGACGGGAACTGCACGAT 60 ---------|---------|---------|---------|---------|---------| 61 CTACCTGGCGAGCCTGGAGCACGAGCGGGTTCGCTTCGTACGGCGCTGAGCGACAGTCAC 120 ---------|---------|---------|---------|---------|---------| 121 AGGAGAGGAAACGGatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg 180 1 M G S H Q E R P L I G L L F S E 16 ---------|---------|---------|---------|---------|---------| 181 aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg 240 17 T G V T A D I E R S H A Y G A L L A V E 36 ---------|---------|---------|---------|---------|---------| 241 agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300 37 Q L N R E G G V G G R P I E T L S Q D P 56 ---------|---------|---------|---------|---------|---------| 301 ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg 360 57 G G D P D R Y R L C A E D F I R N R G V 76 ---------|---------|---------|---------|---------|---------| 361 tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg 420 77 R F L V G C Y M S H T R K A V M P V V E 96 ---------|---------|---------|---------|---------|---------| 421 agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga 480 97 R A D A L L C Y P T P Y E G F E Y S P N 116 ---------|---------|---------|---------|---------|---------| 481 acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga 540 117 I V Y G G P A P N Q N S A P L A A Y L I 136 ---------|---------|---------|---------|---------|---------| 541 ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa 600 137 R H Y G E R V V F I G S D Y I Y P R E S 156 ---------|---------|---------|---------|---------|---------| 601 gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct 660 157 N H V M R H L Y R Q H G G T V L E E I Y 176 ---------|---------|---------|---------|---------|---------| 661 acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg 720 177 I P L Y P S D D D L Q R A V E R I Y Q A 196 [Part of this file has been deleted for brevity] 1441 GCCGGTGGACGTGGTCTTCACCAGCATTTTCCAGAATGGCCACCACGACGAGATCGCTGC 1500 ---------|---------|---------|---------|---------|---------| 1501 GCTGCTCGCCGCCGGGACTCCGCGCACTACCCTGGTGGCGCTGGTGGAGTACGAAAGCCC 1560 ---------|---------|---------|---------|---------|---------| 1561 CGCGGTGCTCTCGCAGATCATCGAGCTGGAGTGCCACGGCGTGATCACCCAGCCGCTCGA 1620 ---------|---------|---------|---------|---------|---------| 1621 TGCCCACCGGGTGCTGCCTGTGCTGGTATCGGCGCGGCGCATCAGCGAGGAAATGGCGAA 1680 ---------|---------|---------|---------|---------|---------| 1681 GCTGAAGCAGAAGACCGAGCAGCTCCAGGACCGCATCGCCGGCCAGGCCCGGATCAACCA 1740 ---------|---------|---------|---------|---------|---------| 1741 GGCCAAGGTGTTGCTGATGCAGCGCCATGGCTGGGACGAGCGCGAGGCGCACCAGCACCT 1800 ---------|---------|---------|---------|---------|---------| 1801 GTCGCGGGAAGCGATGAAGCGGCGCGAGCCGATCCTGAAGATCGCTCAGGAGTTGCTGGG 1860 ---------|---------|---------|---------|---------|---------| 1861 AAACGAGCCGTCCGCCTGAGCGATCCGGGCCGACCAGAACAATAACAAGAGGGGTATCGT 1920 ---------|---------|---------|---------|---------|---------| 1921 CATCATGCTGGGACTGGTTCTGCTGTACGTTGGCGCGGTGCTGTTTCTCAATGCCGTCTG 1980 ---------|---------|---------|---------|---------|---------| 1981 GTTGCTGGGCAAGATCAGCGGTCGGGAGGTGGCGGTGATCAACTTCCTGGTCGGCGTGCT 2040 ---------|---------|---------|---------|---------|---------| 2041 GAGCGCCTGCGTCGCGTTCTACCTGATCTTTTCCGCAGCAGCCGGGCAGGGCTCGCTGAA 2100 ---------|---------|---------|---------|---------|---------| 2101 GGCCGGAGCGCTGACCCTGCTATTCGCTTTTACCTATCTGTGGGTGGCCGCCAACCAGTT 2160 ------- 2161 CCTCGAG 2167 |
To see the available EMBOSS codon usage files, run:
% embossdata -showall
To fetch one of the codon usage tables (for example 'Emus.cut') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Emus.cut
Program name | Description |
---|---|
abiview | Reads ABI file and display the trace |
backtranseq | Back translate a protein sequence |
cirdna | Draws circular maps of DNA constructs |
coderet | Extract CDS, mRNA and translations from feature tables |
lindna | Draws linear maps of DNA constructs |
pepnet | Displays proteins as a helical net |
pepwheel | Shows protein sequences as helices |
plotorf | Plot potential open reading frames |
prettyplot | Displays aligned sequences, with colouring and boxing |
remap | Display a sequence with restriction cut sites, translation etc |
seealso | Finds programs sharing group names |
showalign | Displays a multiple sequence alignment |
showdb | Displays information on the currently available databases |
showfeat | Show features of a sequence |
showorf | Pretty output of DNA translations |
showseq | Display a sequence with features, translation etc |
sixpack | Display a DNA sequence with 6-frame translation and ORFs |
textsearch | Search sequence documentation text. SRS and Entrez are faster! |
transeq | Translate nucleic acid sequences |
showseq has more options for specifying various ways of displaying a sequence, with or without various ways of translating it.