|
|
shuffleseq |
The number of shuffled sequences output can be set by the '-shuffle' qualifier.
This makes two randomised copies of the input sequence:
% shuffleseq -shuffle 2 Shuffles a set of sequences maintaining composition Input sequence(s): tembl:mmam Output sequence [mmam.fasta]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-sequence] seqall Sequence database USA [-outseq] seqoutall Output sequence(s) USA Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -shuffle integer Number of shuffles Associated qualifiers: "-sequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outseq" associated qualifiers -osformat2 string Output seq format -osextension2 string File name extension -osname2 string Base file name -osdirectory2 string Output directory -osdbname2 string Database name to add -ossingle2 boolean Separate file for each entry -oufo2 string UFO features -offormat2 string Features format -ofname2 string Features file name -ofdirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report deaths |
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -shuffle | Number of shuffles | Any integer value | 1 |
ID MMAM standard; RNA; MUS; 366 BP. XX AC L48662; XX SV L48662.1 XX DT 04-NOV-1995 (Rel. 45, Created) DT 04-MAR-2000 (Rel. 63, Last updated, Version 4) XX DE Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy DE chain mRNA. XX KW . XX OS Mus musculus (house mouse) OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; OC Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. XX RN [1] RP 1-366 RX MEDLINE; 96409289. RX PUBMED; 8814271. RA Wloch M.K., Alexander A.L., Pippen A.M., Pisetsky D.S., Gilkeson G.S.; RT "Differences in V kappa gene utilization and VH CDR3 sequence among RT anti-DNA from C3H-lpr mice and lupus mice with nephritis"; RL Eur. J. Immunol. 26(9):2225-2233(1996). XX FH Key Location/Qualifiers FH FT source 1..366 FT /db_xref="taxon:10090" FT /organism="Mus musculus" FT /strain="C3H/HeJ-lpr/lpr" FT /cell_line="C3H/F2-11" FT /cell_type="hybridoma" FT /tissue_type="spleen" XX SQ Sequence 366 BP; 100 A; 90 C; 85 G; 89 T; 2 other; gagnnccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg 60 tcctgcaagg cttctggata cacattcact agctatgtta tgcactgggt gaatcagaag 120 cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaactac 180 aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac 240 atggagttca gcagcctgac ctctgaggac tctgcggtct attactgtgc aagaaaaact 300 tcctactata gtaacctata ttactttgac tactggggcc aaggcaccac tctcacagtc 360 tcctca 366 // |
>MMAM L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA. cagagtctcacccaagaaacggtcaaatctacgttaacccccatgctgncgtaacctgga gatagctagccttcagggccatcctcgttccaaacgatgtcaaattatcgcgtgaggact ggcattagtgctcgttcttatctnatgctttccatctcgggcttgcttgtaaaataattg atagggtgtaggacaccgaacgaggataccgctgcttaaaacaatagctctgctgctggt agggctctagggactaagtaccttctttaaggccctcgcacctgataaatcggtaaaagg attcgaggctgaaaaaacgattcatctaactagcgacagctccgagtgcgaaagcgatat gcgacc >MMAM L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA. tctttagcggggtgctcggccctgtcgttagngaggcacgcaccggcatactgtttaccc aaaccgatccagagtagcaaagcgataaattacttatttagcaaatgccatggaatgact tgtaaccggctaaggcgaacagccttcacgcggtccatagactacttgttctcagttcca atacaccctcaagaaaagtgataaattaagctatgggcggaccgaaagggttccgtttta caatctgctaactccacggttcggaactatacccacttgatagtcgttcttgngagacgt tccaacaccaaacaatttacggacacgctggtaagacaattagcgagtcgctgggatgcc ttggtg |
Each run will produce a different sequence.
Note that these two sequences have the same name.
| Program name | Description |
|---|---|
| msbar | Mutate sequence beyond all recognition |