![]() |
supermatcher |
% supermatcher tembl:ec* tembl:eclac -word 50 Finds a match of a large sequence against one or more sequences Gap opening penalty [10.0]: Gap extension penalty [0.5]: 3.0 Output alignment [eclac.supermatcher]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-asequence] seqall Sequence database USA [-bsequence] seqset Sequence set USA -gapopen float Gap opening penalty -gapextend float Gap extension penalty [-outfile] align Output alignment file name Additional (Optional) qualifiers: -datafile matrixf This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. -width integer Alignment width -wordlen integer Word length for initial matching -errorfile outfile Error file to be written to Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-asequence" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-bsequence" associated qualifiers -sbegin2 integer Start of each sequence to be used -send2 integer End of each sequence to be used -sreverse2 boolean Reverse (if DNA) -sask2 boolean Ask for begin/end/reverse -snucleotide2 boolean Sequence is nucleotide -sprotein2 boolean Sequence is protein -slower2 boolean Make lower case -supper2 boolean Make upper case -sformat2 string Input sequence format -sdbname2 string Database name -sid2 string Entryname -ufo2 string UFO features -fformat2 string Features format -fopenfile2 string Features file name "-outfile" associated qualifiers -aformat3 string Alignment format -aextension3 string File name extension -adirectory3 string Output directory -aname3 string Base file name -awidth3 integer Alignment width -aaccshow3 boolean Show accession number in the header -adesshow3 boolean Show description in the header -ausashow3 boolean Show the full USA in the alignment -aglobal3 boolean Show the full sequence in alignment "-errorfile" associated qualifiers -odirectory string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report deaths |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-asequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
[-bsequence] (Parameter 2) |
Sequence set USA | Readable set of sequences | Required |
-gapopen | Gap opening penalty | Number from 1.000 to 100.000 | 10.0 for any sequence type |
-gapextend | Gap extension penalty | Number from 0.100 to 10.000 | 0.5 for any sequence type |
[-outfile] (Parameter 3) |
Output alignment file name | Alignment output file | |
Additional (Optional) qualifiers | Allowed values | Default | |
-datafile | This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. | Comparison matrix file in EMBOSS data path | EBLOSUM62 for protein EDNAFULL for DNA |
-width | Alignment width | Integer 1 or more | 16 |
-wordlen | Word length for initial matching | Integer 3 or more | 6 |
-errorfile | Error file to be written to | Output file | supermatcher.error |
Advanced (Unprompted) qualifiers | Allowed values | Default | |
(none) |
ID ECLAC standard; DNA; PRO; 7477 BP. XX AC J01636; J01637; K01483; K01793; XX SV J01636.1 XX DT 30-NOV-1990 (Rel. 26, Created) DT 04-MAR-2000 (Rel. 63, Last updated, Version 7) XX DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes. XX KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon; KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene; KW lacZ gene; mutagenesis; palindrome; promoter region; KW thiogalactoside acetyltransferase. XX OS Escherichia coli OC Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae; OC Escherichia. XX RN [1] RP 1243-1266 RX MEDLINE; 74055539. RA Gilbert W., Maxam A.; RT "The nucleotide sequence of the lac operator"; RL Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973). XX RN [2] RP 1246-1308 RX MEDLINE; 74055540. RA Maizels N.M.; RT "The nucleotide sequence of the lactose messenger ribonucleic acid RT transcribed from the UV5 promoter mutant of Escherichia coli"; RL Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973). XX RN [3] RX MEDLINE; 74174501. RA Gilbert W., Maizels N., Maxam A.; RT "Sequences of controlling regions of the lactose operon"; RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974). XX RN [4] RA Gilbert W., Gralla J., Majors A.J., Maxam A.; RT "Lactose operator sequences and the action of lac repressor"; RL (in) Sund H., Blauer G. (eds.); RL PROTEIN-LIGAND INTERACTIONS:193-207; RL Walter de Gruyter, New York (1975) XX RN [5] RP 1146-1282 [Part of this file has been deleted for brevity] cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560 ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620 ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680 ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740 gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800 aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860 gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920 ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980 cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040 agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100 gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160 ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220 ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280 ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340 cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400 tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460 tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520 atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580 gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640 gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700 caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760 gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820 taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880 aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940 acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000 atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060 ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120 taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180 tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240 tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300 attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360 ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420 gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480 gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540 atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600 atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660 gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720 accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780 agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840 ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900 tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960 taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020 acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080 caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140 tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200 gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260 ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320 cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380 actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440 cagcccgccc atggtaacca ccggcagagc ggtcgac 7477 // |
The output is a standard EMBOSS alignment file.
The results can be output in one of several styles by using the command-line qualifier -aformat xxx, where 'xxx' is replaced by the name of the required format. Some of the alignment formats can cope with an unlimited number of sequences, while others are only for pairs of sequences.
The available multiple alignment format names are: unknown, multiple, simple, fasta, msf, trace, srs
The available pairwise alignment format names are: pair, markx0, markx1, markx2, markx3, markx10, srspair, score
See: Themes/AlignFormats.html for further information on alignment formats.
The output alignment is in simple format by default.
######################################## # Program: supermatcher # Rundate: Tue Apr 06 14:34:25 2004 # Align_format: simple # Report_file: eclac.supermatcher ######################################## #======================================= # # Aligned_sequences: 2 # 1: ECLAC # 2: ECLAC # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 3.0 # # Length: 7477 # Identity: 7477/7477 (100.0%) # Similarity: 7477/7477 (100.0%) # Gaps: 0/7477 ( 0.0%) # Score: 37385.0 # # #======================================= ECLAC 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50 ECLAC 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100 ECLAC 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150 ECLAC 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200 ECLAC 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250 ECLAC 251 gcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac 300 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 251 gcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac 300 ECLAC 301 gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactggg 350 |||||||||||||||||||||||||||||||||||||||||||||||||| [Part of this file has been deleted for brevity] ECLACZ 2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 2550 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 3836 ECLACZ 2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 2600 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 3886 ECLACZ 2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 2650 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 3936 ECLACZ 2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 2700 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 3986 ECLACZ 2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 2750 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 4036 ECLACZ 2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 2800 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 4086 ECLACZ 2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 2850 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 4136 ECLACZ 2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 2900 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 4186 ECLACZ 2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 2950 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 4236 ECLACZ 2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 3000 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 4286 ECLACZ 3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 3050 |||||||||||||||||||||||||||||||||||||||||||||||||| ECLAC 4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 4336 ECLACZ 3051 gttggtctggtgtcaaaaataataataa 3078 |||||||||||||||||||||||||||| ECLAC 4337 gttggtctggtgtcaaaaataataataa 4364 #--------------------------------------- #--------------------------------------- |
|
The file 'supermatcher.error' will contain any errors that occured during the program. This may be that wordmatch could not find any matches hence no suitable start point is found for the smith-waterman calculation.
Because it does a Smith & Waterman alignment (albeit in a narrow region around the diagonal shown to be the 'best' by a word match), this program can use huge amounts of memory if the sequences are large.
Because the alignment is made within a narrow area each side of the 'best' diagonal, if there are sufficient indels between the two sequences, then the path of the Smith & Waterman alignment can wander outside of this area. Making the width larger can avoid this problem, but you then use more memory.
The longer the sequences and the wider the specified alignment width, the more memory will be used.
If the program terminates due to lack of memory you can try the following:
Run the UNIX command 'limit' to see if your stack or memory usage have been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').
Program name | Description |
---|---|
matcher | Finds the best local alignments between two sequences |
seqmatchall | Does an all-against-all comparison of a set of sequences |
water | Smith-Waterman local alignment |
wordmatch | Finds all exact matches of a given size between 2 sequences |