next up previous
Next: Local alignment Up: Global alignment Previous: Global alignment

Exercise: needle

Program: needle
(Needleman-Wunsch global alignment).
Input sequence:tembl:xlrhodop
Second sequence:tembl:xl23808
Gap opening penalty [10.0]:
Gap extension penalty [0.5]:

Result: 

Global:	XLRHODOP vs XL23808
Score: 7471.00

XLRHODOP

XL23808		1	 cgtaactaggaccccaggtcgacacgacaccttccctttcccagt 45

XLRHODOP

XL23808		46	 tatttcccctgtagacgttagaaggggaaggggtgtacttatgtc 90

XLRHODOP

XL23808		91	 acgacgaactacgtccttgactacttagggccagagagacgaggt 135
$\vdots$

Note that as this is a global alignment, the entire genomic sequence is given in the output, even in regions where it does not line up with the cDNA. Scroll down the output until you reach an area of alignment. 

XLRHODOP	1		   ggtagaacagcttcagttgggatcacaggcttcta 35

				    ||||||||||||||||||||||||||||||||||
XL23808		1171	 tgggtcatactgtagaacagcttcagttgggatcacaggcttcta 1215

XLRHODOP	36	 gggatcctttgggcaaaaaagaaacacagaaggcattctttctat 80
			 |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1216	 gggatcctttgggcaaaaaagaaacacagaaggcattctttctat 1260

XLRHODOP	81	 acaagaaaggactttatagagctgctaccatgaacggaacagaag 125
			 |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1261	 acaagaaaggactttatagagctgctaccatgaacggaacagaag 1305

XLRHODOP	126	 gtccaaatttttatgtccccatgtccaacaaaactggggtggtac 170
			 |||||||||||||||||||||||||||||||||||||||||||||
XL23808		1306	 gtccaaatttttatgtccccatgtccaacaaaactggggtggtac 1350
$\vdots$

We've only shown part of the output as it is very long. You should look at the whole output and note that there are five aligned regions that represent the five exons as predicted from the dotplot.