unix % getorf -opt
Finds and extracts open reading frames (ORFs)
Input sequence: tembl:xlrhodop
Output sequence [xlrhodop.orf]:
Genetic codes
0 : Standard
1 : Standard (with alternative initiation codons)
2 : Vertebrate Mitochondrial
3 : Yeast Mitochondrial
4 : Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma
5 : Invertebrate Mitochondrial
6 : Ciliate Macronuclear and Dasycladacean
9 : Echinoderm Mitochondrial
10 : Euplotid Nuclear
11 : Bacterial
12 : Alternative Yeast Nuclear
13 : Ascidian Mitochondrial
14 : Flatworm Mitochondrial
15 : Blepharisma Macronuclear
Code to use [0]:
Minimum nucleotide size of ORF to report [30]:
Type of sequence to output
0 : Translation of regions between STOP codons
1 : Translation of regions between START and STOP codons
2 : Nucleic sequences between STOP codons
3 : Nucleic sequences between START and STOP codons
4 : Nucleotides flanking START codons
5 : Nucleotides flanking initial STOP codons
6 : Nucleotides flanking ending STOP codons
Type of output [0]: 3
Notice that you can specify the organism whose codon usage table is most appropriate for your sequence, and you can also choose the type of information that is reported to you. In our case, we are simply interested in the positions of the start and stop codons for this sequence.
plotorf is just a graphical representation of the textual information produced by getorf. Since we asked for all ORFs above a minimum size to be reported, getorf is telling us about a number of potential ORFs. We know from plotorf that our ORF will be in the region 100 to 1200, so scroll through the output file, xlrhodop.orf, until you identify this. What are the actual start and end positions?
unix % more xlrhodop.orf
>XLRHODOP_7 [110 - 1171] Xenopus laevis rhodopsin mRNA, complete cds. atgaacggaacagaaggtccaaatttttatgtccccatgtccaacaaaactggggtggta cgaagcccattcgattaccctcagtattacttagcagagccatggcaatattcagcactg
