|
Laboration nr.1
a) Convert this sequence to fasta format b) Please find the name of the gene this sequence belongs to. (Use any blast server mentioned during the previous lecture). c) Which gene product does this gene code for (Protein)? Can you translate? d) Please find out the coding region of the gene (in base pairs) (remember this mornings lecture about database fields ;-))? e) Can you find out the protein family this protein belongs to? You can use different tools! f) Chromosome location? And some key publications for this gene? Use the easy way you learned in the previous lecture! (Use the web services described during todays lectures ) Here is the sequence: ACTTACAGCTGAGTGAGATAATGCCTGGGTTATGAAATCAAAAAGTTGGAAAGCAGGTCA |